Notably, the diffusion of FITC-dextran was not observed, confirming that the excreted glucose was not the result of diffusion, but occurred via the glucose transporter (Supplementary Fig
Prioritizing restorative sleep, engaging in cognitive learning activities, and maintaining healthy stress management practices may further help reinforce neural resilience pathways associated with BDNF and synaptic plasticity
Viral infection For lentiviral production, HEK293T cells were co-transfected with 4 g 8.91, 1 g pVSVG, 5 g of lentivector (shRNA targeting SHMT2 : CCAGAATTTGTAGCTGAGATT, and ATF4 : GCGAGTGTAAGGAGCTAGAAA, obtained from RNA Technology platform and Gene manipulating core, Academia Sinica) by using 30 L of Turbofect (Thermo, R0533) in 1 mL of Opti-MEM (Gibco, 31985070) according to the manufacturers instructions
Rasool M, Malik A, Saleem S, Ashraf MAB, Khan AQ, Waquar S et al (2021) Role of oxidative stress and the identification of biomarkers associated with thyroid dysfunction in schizophrenics
How Becura Celluglow Stands Out When it comes to glutathione with NAC, not all supplements are created equal
